
BioSQL is a generic database schema designed mainly to store sequences and its related data for all RDBMS engine. It is designed in such a way that it holds the data from all popular bioinformatics databases like GenBank, Swissport, etc. It can be used to store in-house data as well.
BioSQL currently provides specific schema for the below databases −
It also provides minimal support for Java based HSQLDB and Derby databases.
BioPython provides very simple, easy and advanced ORM capabilities to work with BioSQL based database. BioPython provides a module, BioSQL to do the following functionality −
Before going deep into the BioSQL, let us understand the basics of BioSQL schema. BioSQL schema provides 25+ tables to hold sequence data, sequence feature, sequence category/ontology and taxonomy information. Some of the important tables are as follows −
In this section, let us create a sample BioSQL database, biosql using the schema provided by the BioSQL team. We shall work with SQLite database as it is really easy to get started and does not have complex setup.
Here, we shall create a SQLite based BioSQL database using the below steps.
Step 1 − Download the SQLite databse engine and install it.
Step 2 − Download the BioSQL project from the GitHub URL. https://github.com/biosql/biosql
Step 3 − Open a console and create a directory using mkdir and enter into it.
cd /path/to/your/biopython/sample mkdir sqlite-biosql cd sqlite-biosql
Step 4 − Run the below command to create a new SQLite database.
> sqlite3.exe mybiosql.db SQLite version 3.25.2 2018-09-25 19:08:10 Enter ".help" for usage hints. sqlite>
Step 5 − Copy the biosqldb-sqlite.sql file from the BioSQL project (/sql/biosqldb-sqlite.sql`) and store it in the current directory.
Step 6 − Run the below command to create all the tables.
sqlite> .read biosqldb-sqlite.sql
Now, all tables are created in our new database.
Step 7 − Run the below command to see all the new tables in our database.
sqlite> .headers on sqlite> .mode column sqlite> .separator ROW "\n" sqlite> SELECT name FROM sqlite_master WHERE type = 'table'; biodatabase taxon taxon_name ontology term term_synonym term_dbxref term_relationship term_relationship_term term_path bioentry bioentry_relationship bioentry_path biosequence dbxref dbxref_qualifier_value bioentry_dbxref reference bioentry_reference comment bioentry_qualifier_value seqfeature seqfeature_relationship seqfeature_path seqfeature_qualifier_value seqfeature_dbxref location location_qualifier_value sqlite>
The first three commands are configuration commands to configure SQLite to show the result in a formatted manner.
Step 8 − Copy the sample GenBank file, ls_orchid.gbk provided by BioPython team https://raw.githubusercontent.com/biopython/biopython/master/Doc/examples/ls_orchid.gbk into the current directory and save it as orchid.gbk.
Step 9 − Create a python script, load_orchid.py using the below code and execute it.
from Bio import SeqIO
from BioSQL import BioSeqDatabase
import os
server = BioSeqDatabase.open_database(driver = 'sqlite3', db = "orchid.db")
db = server.new_database("orchid")
count = db.load(SeqIO.parse("orchid.gbk", "gb"), True) server.commit()
server.close()
The above code parses the record in the file and converts it into python objects and inserts it into BioSQL database. We will analyze the code in later section.
Finally, we created a new BioSQL database and load some sample data into it. We shall discuss the important tables in the next chapter.
biodatabase table is in the top of the hierarchy and its main purpose is to organize a set of sequence data into a single group/virtual database. Every entry in the biodatabase refers to a separate database and it does not mingle with another database. All the related tables in the BioSQL database have references to biodatabase entry.
bioentry table holds all the details about a sequence except the sequence data. sequence data of a particular bioentry will be stored in biosequence table.
taxon and taxon_name are taxonomy details and every entry refers this table to specify its taxon information.
After understanding the schema, let us look into some queries in the next section.
Let us delve into some SQL queries to better understand how the data are organized and the tables are related to each other. Before proceeding, let us open the database using the below command and set some formatting commands −
> sqlite3 orchid.db SQLite version 3.25.2 2018-09-25 19:08:10 Enter ".help" for usage hints. sqlite> .header on sqlite> .mode columns
.header and .mode are formatting options to better visualize the data. You can also use any SQLite editor to run the query.
List the virtual sequence database available in the system as given below −
select * from biodatabase; *** Result *** sqlite> .width 15 15 15 15 sqlite> select * from biodatabase; biodatabase_id name authority description --------------- --------------- --------------- --------------- 1 orchid sqlite>
Here, we have only one database, orchid.
List the entries (top 3) available in the database orchid with the below given code
select
be.*,
bd.name
from
bioentry be
inner join
biodatabase bd
on bd.biodatabase_id = be.biodatabase_id
where
bd.name = 'orchid' Limit 1,
3;
*** Result ***
sqlite> .width 15 15 10 10 10 10 10 50 10 10
sqlite> select be.*, bd.name from bioentry be inner join biodatabase bd on
bd.biodatabase_id = be.biodatabase_id where bd.name = 'orchid' Limit 1,3;
bioentry_id biodatabase_id taxon_id name accession identifier division description version name
--------------- --------------- ---------- ---------- ---------- ---------- ----------
---------- ---------- ----------- ---------- --------- ---------- ----------
2 1 19 Z78532 Z78532 2765657 PLN
C.californicum 5.8S rRNA gene and ITS1 and ITS2 DN 1
orchid
3 1 20 Z78531 Z78531 2765656 PLN
C.fasciculatum 5.8S rRNA gene and ITS1 and ITS2 DN 1
orchid
4 1 21 Z78530 Z78530 2765655 PLN
C.margaritaceum 5.8S rRNA gene and ITS1 and ITS2 D 1
orchid
sqlite>
List the sequence details associated with an entry (accession − Z78530, name − C. fasciculatum 5.8S rRNA gene and ITS1 and ITS2 DNA) with the given code −
select
substr(cast(bs.seq as varchar), 0, 10) || '...' as seq,
bs.length,
be.accession,
be.description,
bd.name
from
biosequence bs
inner join
bioentry be
on be.bioentry_id = bs.bioentry_id
inner join
biodatabase bd
on bd.biodatabase_id = be.biodatabase_id
where
bd.name = 'orchid'
and be.accession = 'Z78532';
*** Result ***
sqlite> .width 15 5 10 50 10
sqlite> select substr(cast(bs.seq as varchar), 0, 10) || '...' as seq,
bs.length, be.accession, be.description, bd.name from biosequence bs inner
join bioentry be on be.bioentry_id = bs.bioentry_id inner join biodatabase bd
on bd.biodatabase_id = be.biodatabase_id where bd.name = 'orchid' and
be.accession = 'Z78532';
seq length accession description name
------------ ---------- ---------- ------------ ------------ ---------- ---------- -----------------
CGTAACAAG... 753 Z78532 C.californicum 5.8S rRNA gene and ITS1 and ITS2 DNA orchid
sqlite>
Get the complete sequence associated with an entry (accession − Z78530, name − C. fasciculatum 5.8S rRNA gene and ITS1 and ITS2 DNA) using the below code −
select
bs.seq
from
biosequence bs
inner join
bioentry be
on be.bioentry_id = bs.bioentry_id
inner join
biodatabase bd
on bd.biodatabase_id = be.biodatabase_id
where
bd.name = 'orchid'
and be.accession = 'Z78532';
*** Result ***
sqlite> .width 1000
sqlite> select bs.seq from biosequence bs inner join bioentry be on
be.bioentry_id = bs.bioentry_id inner join biodatabase bd on bd.biodatabase_id =
be.biodatabase_id where bd.name = 'orchid' and be.accession = 'Z78532';
seq
----------------------------------------------------------------------------------------
----------------------------
CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGACAACAGAATATATGATCGAGTGAATCT
GGAGGACCTGTGGTAACTCAGCTCGTCGTGGCACTGCTTTTGTCGTGACCCTGCTTTGTTGTTGGGCCTCC
TCAAGAGCTTTCATGGCAGGTTTGAACTTTAGTACGGTGCAGTTTGCGCCAAGTCATATAAAGCATCACTGATGAATGACATTATTGT
CAGAAAAAATCAGAGGGGCAGTATGCTACTGAGCATGCCAGTGAATTTTTATGACTCTCGCAACGGATATCTTGGCTC
TAACATCGATGAAGAACGCAG
sqlite>
List taxon associated with bio database, orchid
select distinct
tn.name
from
biodatabase d
inner join
bioentry e
on e.biodatabase_id = d.biodatabase_id
inner join
taxon t
on t.taxon_id = e.taxon_id
inner join
taxon_name tn
on tn.taxon_id = t.taxon_id
where
d.name = 'orchid' limit 10;
*** Result ***
sqlite> select distinct tn.name from biodatabase d inner join bioentry e on
e.biodatabase_id = d.biodatabase_id inner join taxon t on t.taxon_id =
e.taxon_id inner join taxon_name tn on tn.taxon_id = t.taxon_id where d.name =
'orchid' limit 10;
name
------------------------------
Cypripedium irapeanum
Cypripedium californicum
Cypripedium fasciculatum
Cypripedium margaritaceum
Cypripedium lichiangense
Cypripedium yatabeanum
Cypripedium guttatum
Cypripedium acaule
pink lady's slipper
Cypripedium formosanum
sqlite>
Let us learn how to load sequence data into the BioSQL database in this chapter. We already have the code to load data into the database in previous section and the code is as follows −
from Bio import SeqIO
from BioSQL import BioSeqDatabase
import os
server = BioSeqDatabase.open_database(driver = 'sqlite3', db = "orchid.db")
DBSCHEMA = "biosqldb-sqlite.sql"
SQL_FILE = os.path.join(os.getcwd(), DBSCHEMA)
server.load_database_sql(SQL_FILE)
server.commit()
db = server.new_database("orchid")
count = db.load(SeqIO.parse("orchid.gbk", "gb"), True) server.commit()
server.close()
We will have a deeper look at every line of the code and its purpose −
Line 1 − Loads the SeqIO module.
Line 2 − Loads the BioSeqDatabase module. This module provides all the functionality to interact with BioSQL database.
Line 3 − Loads os module.
Line 5 − open_database opens the specified database (db) with the configured driver (driver) and returns a handle to the BioSQL database (server). Biopython supports sqlite, mysql, postgresql and oracle databases.
Line 6-10 − load_database_sql method loads the sql from the external file and executes it. commit method commits the transaction. We can skip this step because we already created the database with schema.
Line 12 − new_database methods creates new virtual database, orchid and returns a handle db to execute the command against the orchid database.
Line 13 − load method loads the sequence entries (iterable SeqRecord) into the orchid database. SqlIO.parse parses the GenBank database and returns all the sequences in it as iterable SeqRecord. Second parameter (True) of the load method instructs it to fetch the taxonomy details of the sequence data from NCBI blast website, if it is not already available in the system.
Line 14 − commit commits the transaction.
Line 15 − close closes the database connection and destroys the server handle.
Let us fetch a sequence with identifier, 2765658 from the orchid database as below −
from BioSQL import BioSeqDatabase
server = BioSeqDatabase.open_database(driver = 'sqlite3', db = "orchid.db")
db = server["orchid"]
seq_record = db.lookup(gi = 2765658)
print(seq_record.id, seq_record.description[:50] + "...")
print("Sequence length %i," % len(seq_record.seq))
Here, server["orchid"] returns the handle to fetch data from virtual databaseorchid. lookup method provides an option to select sequences based on criteria and we have selected the sequence with identifier, 2765658. lookup returns the sequence information as SeqRecordobject. Since, we already know how to work with SeqRecord`, it is easy to get data from it.
Removing a database is as simple as calling remove_database method with proper database name and then committing it as specified below −
from BioSQL import BioSeqDatabase
server = BioSeqDatabase.open_database(driver = 'sqlite3', db = "orchid.db")
server.remove_database("orchids")
server.commit()